Stem-loop sequence dan-mir-92a

AccessionMI0008949 (change log)
DescriptionDrosophila ananassae miR-92a stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   au      uu        a     -     u   g    ugaa 
5'   acaaau  cccguagg cggga aggug caa guuu    u
     ||||||  |||||||| ||||| ||||| ||| ||||    u
3'   uguuug  ggguaucc gcccu uucac guu caaa    a
   ac      gc        g     g     -   a    uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13340: 3727777-3727863 [+]
intergenic
Clustered miRNAs
< 10kb from dan-mir-92a
dan-mir-92ascaffold_13340: 3727777-3727863 [+]
dan-mir-92bscaffold_13340: 3732646-3732733 [+]
Database links

Mature sequence dan-miR-92a

Accession MIMAT0008412
Sequence

53 - 

cauugcacuugucccggccuau

 - 74

Get sequence
Evidence by similarity; MI0000357

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).