Stem-loop sequence dmo-mir-313

AccessionMI0009250 (change log)
DescriptionDrosophila mojavensis miR-313 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   -              uu   u    u   u ua 
5'  uuuccgguugugaa  gug caau cuu u  u
    ||||||||||||||  ||| |||| ||| |   
3'  aaaggccggcacuu  cac guua gaa a  u
   a              uu   -    u   c uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6496: 9090671-9090736 [-]
intergenic
Database links

Mature sequence dmo-miR-313

Accession MIMAT0008696
Sequence

42 - 

uauugcacuuuucacggccgga

 - 63

Get sequence
Evidence by similarity; MI0000425

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).