Stem-loop sequence cte-mir-92c

AccessionMI0010066 (change log)
Previous IDscap-mir-92c
DescriptionCapitella teleta miR-92c stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   --auuauuac      -ga  g      u      cg     cc   ucu   u 
5'           gucagu   ag aggucg gacaag  gcaau  ugg   ggc g
             ||||||   || |||||| ||||||  |||||  |||   |||  
3'           caguca   uc uccggc cuguuc  cguua  acc   ucg a
   cugcacucuc      gac  g      c      -a     --   ---   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB294417.1: 594205-594305 [-]
intergenic
Clustered miRNAs
< 10kb from cte-mir-92c
cte-mir-92bKB294417.1: 595219-595319 [-]
cte-mir-92aKB294417.1: 594329-594429 [-]
cte-mir-92cKB294417.1: 594205-594305 [-]
Database links

Mature sequence cte-miR-92c

Accession MIMAT0009522
Previous IDscap-miR-92c
Sequence

61 - 

auugcacuugucccggccugcu

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).