Stem-loop sequence cte-mir-1995

AccessionMI0010235 (change log)
Previous IDscap-mir-1995
DescriptionCapitella teleta miR-1995 stem-loop
Stem-loop
   cag    -       cugu    c  g     u      c   u 
5'    ggcg aaguuuu    acau uc cauug gaccau ugu g
      |||| |||||||    |||| || ||||| |||||| ||| u
3'    cugc uucgaaa    ugua ag guaac uuggua gca u
   gag    c       uagu    u  g     u      c   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB305899.1: 114734-114823 [+]
intergenic
Database links

Mature sequence cte-miR-1995

Accession MIMAT0009706
Previous IDscap-miR-1995
Sequence

17 - 

guacaucucgcauugugaccau

 - 38

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).