Stem-loop sequence mtr-MIR1510a

AccessionMI0010542 (change log)
DescriptionMedicago truncatula miR1510a stem-loop
Gene family MIPF0000703; MIR1510
Literature search

1 open access papers mention mtr-MIR1510a
(2 sentences)

Stem-loop
        ug   u      u     c     cau      c    cauaaa        a  u    c  c      u    cca 
5' aaagu  cua ugcaau guugu uuacc   uccucc aucc      ucuauuau ug acuc au aucaua ggau   c
   |||||  ||| |||||| ||||| |||||   |||||| ||||      |||||||| || |||| || |||||| ||||    
3' uuucg  gau acguua caaca aaugg   aggagg uagg      ggauagua gc ugag ua uaguau ucug   u
        --   u      u     a     auu      c    uucuaa        c  -    a  a      -    uuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 18616293-18616456 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR1510a
mtr-MIR1510bchr5: 18612353-18612588 [+]
mtr-MIR1510achr5: 18616293-18616456 [+]
mtr-MIR2592jchr5: 18620902-18621150 [+]
Database links

Mature sequence mtr-miR1510a-5p

Accession MIMAT0010032
Previous IDsmtr-miR1510a*
Sequence

20 - 

uugucuuacccauuccuccca

 - 40

Get sequence
Evidence experimental; Illumina [1], Northern [1]

Mature sequence mtr-miR1510a-3p

Accession MIMAT0010033
Previous IDsmtr-miR1510a
Sequence

128 - 

cggaggauuagguaaaacaac

 - 148

Get sequence
Evidence experimental; Illumina [1], Northern [1], 454 [2]

References

1
PMID:19068109 "High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families" Szittya G, Moxon S, Santos DM, Jing R, Fevereiro MP, Moulton V, Dalmay T BMC Genomics. 9:593(2008).
2
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).