Stem-loop sequence cbr-mir-2226

AccessionMI0011016 (change log)
DescriptionCaenorhabditis briggsae miR-2226 stem-loop
Stem-loop
   -    --         u  a   a    ga   a   gc       ccaau 
5'  ggcu  agacaugcc gc aug caca  aga cug  aaugaaa     a
    ||||  ||||||||| || ||| ||||  ||| |||  |||||||     c
3'  ccga  ucugugcgg cg uac gugu  ucu ggc  uuacuuu     u
   a    uc         u  a   c    -g   -   -a       auuca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrIII: 869446-869544 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-2226
cbr-mir-2226chrIII: 869446-869544 [-]
cbr-mir-64cchrIII: 869360-869420 [-]
cbr-mir-64achrIII: 869205-869314 [-]
cbr-mir-64bchrIII: 869080-869196 [-]
cbr-mir-65chrIII: 868808-868904 [-]
Database links

Mature sequence cbr-miR-2226-5p

Accession MIMAT0011499
Previous IDscbr-miR-2226
Sequence

17 - 

aaugacacagaagaacuggcaaug

 - 40

Get sequence
Evidence experimental; 454 [1]

Mature sequence cbr-miR-2226-3p

Accession MIMAT0011500
Previous IDscbr-miR-2226*
Sequence

61 - 

auuacggucugugugccauagc

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).