Stem-loop sequence crm-mir-64c

AccessionMI0011091 (change log)
DescriptionCaenorhabditis remanei miR-64c stem-loop
Gene family MIPF0000967; mir-64_2
Literature search

1 open access papers mention crm-mir-64c
(26 sentences)

Stem-loop
   -     ---uuaacca a   -        a a         c    aa      -   auc 
5'  auaca          g ggc cucgccga u ugacacuga gcuu  uaugga ccg   u
    |||||          | ||| |||||||| | ||||||||| ||||  |||||| |||    
3'  uaugu          c ccg gagcggcu a acugugacu cgaa  auaccu ggc   c
   u     uaaucccccg c   u        c a         -    -a      a   ccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig41: 72317-72434 [+]
intergenic
Clustered miRNAs
< 10kb from crm-mir-64c
crm-mir-7613Crem_Contig41: 71834-71894 [+]
crm-mir-64aCrem_Contig41: 71965-72073 [+]
crm-mir-66Crem_Contig41: 72081-72200 [+]
crm-mir-64bCrem_Contig41: 72225-72316 [+]
crm-mir-64cCrem_Contig41: 72317-72434 [+]
crm-mir-64dCrem_Contig41: 72472-72586 [+]
crm-mir-64eCrem_Contig41: 72615-72729 [+]
Database links

Mature sequence crm-miR-64c-5p

Accession MIMAT0011591
Previous IDscrm-miR-64c
Sequence

27 - 

uaugacacugacgcuuaauaugg

 - 49

Get sequence
Evidence experimental; 454 [1]

Mature sequence crm-miR-64c-3p

Accession MIMAT0011592
Previous IDscrm-miR-64c*
Sequence

68 - 

cauaaaagcucagugucaaacu

 - 89

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).