Stem-loop sequence ppc-mir-2232-1

AccessionMI0011131 (change log)
DescriptionPristionchus pacificus miR-2232-1 stem-loop
Gene family MIPF0001054; mir-2232
Stem-loop
   c  a       auc  au    a       -   -    g      -  aua u 
5'  ug gagaccc   cg  ccug acgguuc ccu ggug cauggu cg   c a
    || |||||||   ||  |||| ||||||| ||| |||| |||||| ||   |  
3'  ac cuuuggg   gc  ggac ugucaag ggg ccac guauca gc   g a
   a  -       ---  --    c       c   u    a      a  -ga u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000119.1: 562163-562262 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-2232-1
ppc-mir-63aABKE03000119.1: 561812-561931 [+]
ppc-mir-2232-1ABKE03000119.1: 562163-562262 [+]
Database links

Mature sequence ppc-miR-2232

Accession MIMAT0011643
Sequence

63 - 

uaugacaccugggcgaacugucc

 - 85

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).