Stem-loop sequence ppc-mir-63c-1

AccessionMI0011139 (change log)
DescriptionPristionchus pacificus miR-63c-1 stem-loop
Gene family MIPF0000823; mir-63
Stem-loop
          -a      g           -      -    u       c  gau 
5' gaaucau  guccau ugggguuccau ucgcau gagu ucaugga uc   u
   |||||||  |||||| ||||||||||| |||||| |||| ||||||| ||    
3' cuuggua  cgggug gcuccagggua agcgua cuca aguaucu ag   c
          ac      -           g      a    c       -  aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000073.1: 892478-892580 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-63c-1
ppc-mir-63c-1ABKE03000073.1: 892478-892580 [+]
ppc-mir-63c-4ABKE03000073.1: 892769-892884 [+]
ppc-mir-63c-3ABKE03000073.1: 892918-893033 [+]
ppc-mir-63c-3ABKE03000073.1: 893067-893182 [+]
ppc-mir-63c-4ABKE03000073.1: 893216-893331 [+]
ppc-mir-63fABKE03000073.1: 893370-893471 [+]
Database links

Mature sequence ppc-miR-63c

Accession MIMAT0011651
Sequence

60 - 

uaugacacucaaugcgagauggg

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).