Stem-loop sequence ppc-mir-63f

AccessionMI0011157 (change log)
DescriptionPristionchus pacificus miR-63f stem-loop
Gene family MIPF0000823; mir-63
Stem-loop
   c     ---cu    ccu            -    -g   u       -  uuc 
5'  agagc     ucca   gggguuccauuc guau  agu ucaugga cu   c
    |||||     ||||   |||||||||||| ||||  ||| ||||||| ||    
3'  ucuug     aggu   ccccaaggugag cgug  uca aguaucu ga   c
   -     auaau    -au            g    ag   c       c  cau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000073.1: 893370-893471 [+]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-63f
ppc-mir-63c-1ABKE03000073.1: 892478-892580 [+]
ppc-mir-63c-4ABKE03000073.1: 892769-892884 [+]
ppc-mir-63c-3ABKE03000073.1: 892918-893033 [+]
ppc-mir-63c-3ABKE03000073.1: 893067-893182 [+]
ppc-mir-63c-4ABKE03000073.1: 893216-893331 [+]
ppc-mir-63fABKE03000073.1: 893370-893471 [+]
Database links

Mature sequence ppc-miR-63f

Accession MIMAT0011664
Sequence

59 - 

uaugacacugagugcggagugg

 - 80

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).