Stem-loop sequence ppc-mir-65

AccessionMI0011158 (change log)
DescriptionPristionchus pacificus miR-65 stem-loop
Stem-loop
   -   g  cg u      uu         a   cu        -  g aua 
5'  uca uc  c gcccuu  augacacug ccc  caaugcgg au u   a
    ||| ||  | ||||||  ||||||||| |||  |||||||| || |    
3'  agu ag  g cgggaa  uacugugac ggg  guuacgcc ua a   c
   g   a  -a u      cc         -   -u        a  g ggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (El_Paco; GCA_000180635.3) Overlapping transcripts
ABKE03000119.1: 316794-316890 [-]
intergenic
Clustered miRNAs
< 10kb from ppc-mir-65
ppc-mir-2246ABKE03000119.1: 316972-317071 [-]
ppc-mir-65ABKE03000119.1: 316794-316890 [-]
ppc-mir-8354ABKE03000119.1: 316679-316739 [-]
Database links

Mature sequence ppc-miR-65

Accession MIMAT0011665
Sequence

18 - 

uaugacacugaccccucaaugcgg

 - 41

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).