Stem-loop sequence dps-mir-190

AccessionMI0011596 (change log)
DescriptionDrosophila pseudoobscura miR-190 stem-loop
Gene family MIPF0000076; mir-190
Stem-loop
   a     g  uc      -            au      u  uu  auu 
5'  uuggg au  caguga gauauguuugau  ucuugg ug  ac   c
    ||||| ||  |||||| ||||||||||||  |||||| ||  ||    
3'  ggccc ua  gucauu uuauacaaacua  aggacc ac  ug   a
   a     a  gu      a            --      c  -u  aga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XR_group3a: 147703-147796 [-]
intergenic
Database links

Mature sequence dps-miR-190-5p

Accession MIMAT0012227
Previous IDsdps-miR-190*
Sequence

17 - 

agauauguuugauauucuugguug

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-190-3p

Accession MIMAT0012228
Previous IDsdps-miR-190
Sequence

58 - 

cccaggaaucaaacauauuauua

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).