Stem-loop sequence dps-mir-2553

AccessionMI0011695 (change log)
DescriptionDrosophila pseudoobscura miR-2553 stem-loop
Stem-loop
   u   uac    --------         c    a   uc g        auacauaca 
5'  uug   acca        acauuugug gucu aga  u ugcaguau         u
    |||   ||||        ||||||||| |||| |||  | ||||||||          
3'  aac   uggu        uguaaacau caga ucu  a acguuaua         a
   a   uuc    cugucaag         -    c   uc g        aaacauaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
3: 8680021-8680129 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2553
dps-mir-25513: 8678482-8678601 [+]
dps-mir-25523: 8679230-8679342 [+]
dps-mir-3113: 8679717-8679827 [+]
dps-mir-92c3: 8679866-8679980 [+]
dps-mir-25533: 8680021-8680129 [+]
dps-mir-25063: 8680187-8680303 [+]
dps-mir-25543: 8680335-8680451 [+]
dps-mir-2507a3: 8680507-8680614 [+]
dps-mir-2507b3: 8680663-8680779 [+]
Database links

Mature sequence dps-miR-2553-5p

Accession MIMAT0012366
Previous IDsdps-miR-2553
Sequence

19 - 

ugcgucuaagaucugugcaguau

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-2553-3p

Accession MIMAT0012367
Previous IDsdps-miR-2553*
Sequence

63 - 

uauugcagacuucucagacuaca

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).