Stem-loop sequence dsi-mir-959

AccessionMI0011777 (change log)
DescriptionDrosophila simulans miR-959 stem-loop
Gene family MIPF0000910; mir-959
Stem-loop
   -     uu       - u        gg u        ac    uc 
5'  cuuug  cuauauu c uaguacuc  g ugauaaag  cuuu  u
    |||||  ||||||| | ||||||||  | ||||||||  ||||  u
3'  gaaau  gauauaa g auuauggg  c acuguuuc  gagg  u
   a     uu       a u        gg u        -c    cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2L: 5434030-5434121 [+]
intergenic
Clustered miRNAs
< 10kb from dsi-mir-959
dsi-mir-959chr2L: 5434030-5434121 [+]
dsi-mir-960chr2L: 5434148-5434244 [+]
dsi-mir-961chr2L: 5434266-5434376 [+]
dsi-mir-962chr2L: 5434384-5434477 [+]
dsi-mir-963chr2L: 5435040-5435157 [+]
dsi-mir-964chr2L: 5435195-5435286 [+]
Database links

Mature sequence dsi-miR-959

Accession MIMAT0012508
Sequence

57 - 

uugucaucggggguauuaugaa

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).