Stem-loop sequence dpu-mir-92

AccessionMI0012253 (change log)
DescriptionDaphnia pulex miR-92 stem-loop
Gene family MIPF0000013; mir-25
Literature search

3 open access papers mention dpu-mir-92
(27 sentences)

Stem-loop
   accuuga     aacc   uga     uu   uu g    c    uuuaa 
5'        uaguc    uua   aggcu  gac  g gcaa uucg     a
          |||||    |||   |||||  |||  | |||| ||||     u
3'        aucag    aau   uccgg  cug  c cguu aagc     g
   caaaaaa     -guc   ucg     cc   cu a    -    uguuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (V1.0; GCA_000187875.1) Overlapping transcripts
GL732560.1: 876310-876410 [+]
intergenic
Database links

Mature sequence dpu-miR-92

Accession MIMAT0012672
Sequence

61 - 

aauugcacucgucccggccugc

 - 82

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).