Stem-loop sequence eca-mir-367

AccessionMI0012674 (change log)
DescriptionEquus caballus miR-367 stem-loop
Gene family MIPF0000162; mir-367
Literature search

2 open access papers mention eca-mir-367
(2 sentences)

Stem-loop
     a             ua     c   -   ca 
5' cc ucacuguugcuaa  ugcaa ucu guu  a
   || |||||||||||||  ||||| ||| |||  u
3' gg agugguaacgauu  acguu agg caa  a
     c             uc     a   u   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr2: 113629662-113629729 [+]
antisense
ENSECAT00000001702 ; LARP7-201; intron 8
ENSECAT00000001915 ; LARP7-202; intron 8
Clustered miRNAs
< 10kb from eca-mir-367
eca-mir-302bchr2: 113629063-113629138 [+]
eca-mir-302cchr2: 113629201-113629268 [+]
eca-mir-302achr2: 113629373-113629440 [+]
eca-mir-302dchr2: 113629533-113629600 [+]
eca-mir-367chr2: 113629662-113629729 [+]
Database links

Mature sequence eca-miR-367

Accession MIMAT0012918
Sequence

44 - 

aauugcacuuuagcaaugguga

 - 65

Get sequence
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).