Stem-loop sequence eca-mir-143

AccessionMI0012807 (change log)
DescriptionEquus caballus miR-143 stem-loop
Gene family MIPF0000094; mir-143
Literature search

1 open access papers mention eca-mir-143
(9 sentences)

Stem-loop
   g  c   g         g      u  -  ag 
5'  cc gag ugcagugcu caucuc gg uc  u
    || ||| ||||||||| |||||| || ||   
3'  gg cuc augucacga guagag cu ag  u
   -  a   g         a      u  g  gg 
Get sequence
Deep sequencing
1199766 reads, 8.92e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr14: 28434698-28434761 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-143
eca-mir-143chr14: 28434698-28434761 [-]
eca-mir-145chr14: 28433270-28433339 [-]
Database links

Mature sequence eca-miR-143

Accession MIMAT0013063
Sequence

41 - 

ugagaugaagcacuguagcuc

 - 61

Get sequence
Deep sequencing1199461 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).