Stem-loop sequence bhv1-mir-B8

AccessionMI0013180 (change log)
DescriptionBovine herpesvirus 1 miR-B8 stem-loop
Gene family MIPF0002021; mir-B8
Stem-loop
          gcg   -a      c       ggaua 
5' cccccgc   ggc  aaaaau caauggc     a
   |||||||   |||  |||||| |||||||      
3' gggggcg   ccg  uuuuua guuaucg     u
          --a   cg      u       agagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bhv1-miR-B8-5p

Accession MIMAT0013970
Sequence

7 - 

cgcgggcaaaaaauccaauggc

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bhv1-miR-B8-3p

Accession MIMAT0013971
Sequence

43 - 

uauuguauuuuugcgccagcggg

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19793906 "Characterization of microRNAs encoded by the bovine herpesvirus 1 genome" Glazov EA, Horwood PF, Assavalapsakul W, Kongsuwan K, Mitchell RW, Mitter N, Mahony TJ J Gen Virol. 91:32-41(2010).