Stem-loop sequence cqu-mir-305

AccessionMI0013582 (change log)
DescriptionCulex quinquefasciatus miR-305 stem-loop
Gene family MIPF0000158; mir-305
Stem-loop
   aa     -     cu u         u  g     cu   ugcu 
5'   uguca caugu  a uguacuuca ca gugcu  ggu    u
     ||||| |||||  | ||||||||| || |||||  |||     
3'   acagu gugua  u acaugaggu gu cacgg  cca    u
   ug     c     au c         u  a     -c   uagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CpipJ1) Overlapping transcripts
supercont3.291: 339120-339207 [+]
intergenic
Clustered miRNAs
< 10kb from cqu-mir-305
cqu-mir-275supercont3.291: 329754-329854 [+]
cqu-mir-305supercont3.291: 339120-339207 [+]
Database links

Mature sequence cqu-miR-305-5p

Accession MIMAT0014382
Previous IDscqu-miR-305
Sequence

15 - 

auuguacuucaucaggugcucu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cqu-miR-305-3p

Accession MIMAT0014383
Previous IDscqu-miR-305*
Sequence

53 - 

cggcacauguuggaguacac

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).