Stem-loop sequence tgu-mir-148b

AccessionMI0013642 (change log)
DescriptionTaeniopygia guttata miR-148b stem-loop
Gene family MIPF0001027; mir-2957
Stem-loop
        ga           ag   a      g  auc 
5' ccgga  caaaguucugu  ugc cugacu cu   g
   |||||  |||||||||||  ||| |||||| ||   u
3' ggccu  guuucaagaca  gug ggcuga ga   a
        uc           cu   a      -  ccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr2: 52006667-52006740 [+]
intergenic
Clustered miRNAs
< 10kb from tgu-mir-148b
tgu-mir-148achr2: 52006663-52006774 [-]
tgu-mir-148bchr2: 52006667-52006740 [+]
Database links

Mature sequence tgu-miR-148b

Accession MIMAT0014455
Sequence

47 - 

ucggagugucacagaacuuugc

 - 68

Get sequence
Evidence experimental; 454 [1], Illumina [1]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).