Stem-loop sequence cel-mir-1829a

AccessionMI0008197 (change log)
DescriptionCaenorhabditis elegans miR-1829a stem-loop
Gene family MIPF0000460; mir-1829
Stem-loop
   --a      c       u   u    aaaa 
5'    agggga uucuaau guu guaa    u
      |||||| ||||||| ||| ||||    c
3'    ucucuu aagguua caa cauu    g
   uua      u       c   -    auga 
Get sequence
Deep sequencing
2288 reads, 0 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 15588311-15588370 [-]
sense
K09A9.5 ; K09A9.5; intron 5
Database links

Mature sequence cel-miR-1829a-5p

Accession MIMAT0015267
Previous IDscel-miR-1829a*
Sequence

1 - 

aaggggacuucuaauuguuugua

 - 23

Get sequence
Deep sequencing1523 reads, 17 experiments
Evidence experimental; CLIPseq [3]
Database links
Predicted targets

Mature sequence cel-miR-1829a-3p

Accession MIMAT0006769
Previous IDscel-miR-1829a
Sequence

39 - 

caaccauuggaauuucucuauu

 - 60

Get sequence
Deep sequencing763 reads, 17 experiments
Evidence experimental; 454 [1], Illumina [2], CLIPseq [3]
Database links
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).
2
3
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).