Stem-loop sequence bmo-mir-3221

AccessionMI0014274 (change log)
DescriptionBombyx mori miR-3221 stem-loop
Stem-loop
   --c   u   -   gaaa uu   u      aaa    gacaggaaaa   -     -  u 
5'    auc uaa cag    u  agc ucgggc   uaga          uga agcuu uc u
      ||| ||| |||    |  ||| ||||||   ||||          ||| ||||| ||  
3'    uag auu guu    a  uug agcccg   aucu          acu ucgga ag u
   uca   c   a   --ag uu   c      --a    ----------   c     c  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581690.1: 2360751-2360855 [-]
intergenic
Database links

Mature sequence bmo-miR-3221

Accession MIMAT0015401
Sequence

67 - 

ucucaucuaagcccgacguuuuaga

 - 91

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).