Stem-loop sequence bmo-mir-3227

AccessionMI0014281 (change log)
DescriptionBombyx mori miR-3227 stem-loop
Gene family MIPF0000826; mir-2807
Stem-loop
   -    aucu      auaa      --   ---u    ---      ca gac     g  ccc   g   u a 
5'  uaaa    ggcaaa    uauagu  cau    agca   auuuuu  g   gcucg ac   aaa acg c u
    ||||    ||||||    ||||||  |||    ||||   ||||||  |   ||||| ||   ||| ||| |  
3'  guuu    ccguuu    auguua  gua    ucgu   ugaaaa  c   ugagu ug   uuu ugu g c
   c    gaau      -gca      ag   uguu    aau      ug aau     g  --a   g   - a 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582009.1: 10373555-10373691 [-]
intergenic
Database links

Mature sequence bmo-miR-3227

Accession MIMAT0015409
Sequence

28 - 

uagcaauuuuucaggacgcucgg

 - 50

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).