Stem-loop sequence bmo-mir-3329

AccessionMI0014387 (change log)
DescriptionBombyx mori miR-3329 stem-loop
Stem-loop
   cc     -a      -c      u     -a    --a   - g      uuaa     
5'   caauc  uuauga  uauugu guguu  gggc   aug a ucacau    aauu 
     |||||  ||||||  |||||| |||||  ||||   ||| | ||||||    ||| u
3'   guuag  aguauu  auaaca uacgg  cccg   uac u ggugua    uuau 
   -u     ac      ua      -     ac    aag   a g      ugag     
Get sequence
Deep sequencing
11 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581745.1: 1154491-1154599 [-]
intergenic
NW_004584580.1: 46-154 [+]
intergenic
NW_004603686.1: 281-389 [+]
intergenic
Database links

Mature sequence bmo-miR-3329

Accession MIMAT0015517
Sequence

84 - 

gcauacaauaauuuaugacagau

 - 106

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).