Stem-loop sequence bmo-mir-3394

AccessionMI0014457 (change log)
DescriptionBombyx mori miR-3394 stem-loop
Stem-loop
   uc    -u   c u  ---a      u    ggu      a  a  c   ag  c   -    ca 
5'   ggcg  ccu g ac    aucgcc uccg   gccuug ug uu ggg  cc caa gcga  u
     ||||  ||| | ||    |||||| ||||   |||||| || || |||  || ||| ||||   
3'   cugc  gga c ug    uagcgg aggc   cggaac ac aa ccc  gg guu cgcu  g
   -u    cc   a u  guac      u    ---      c  c  -   cu  a   a    uu 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581756.1: 226007-226128 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-3394
bmo-mir-3396NW_004581756.1: 232166-232309 [-]
bmo-mir-3395NW_004581756.1: 230693-230814 [-]
bmo-mir-3394NW_004581756.1: 226007-226128 [-]
Database links

Mature sequence bmo-miR-3394

Accession MIMAT0015598
Sequence

13 - 

uacaaucgccuuccgggugccuuga

 - 37

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).