Stem-loop sequence bmo-mir-3347b

AccessionMI0014467 (change log)
DescriptionBombyx mori miR-3347b stem-loop
Gene family MIPF0001022; mir-3347
Stem-loop
   acuu u    ccu  ucu u     -        ggcgguauua       -c    -  ua 
5'     g ggga   gu   g ucagu auguaugc          augagcu  ugcc ca  g
       | ||||   ||   | ||||| ||||||||          |||||||  |||| ||  c
3'     c cucu   cg   c aguua uacaugcg          uacucgg  augg gu  a
   ---g -    -au  -uu u     c        --------ag       ua    c  uc 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581825.1: 86588-86697 [+]
intergenic
Database links

Mature sequence bmo-miR-3347b

Accession MIMAT0015608
Sequence

86 - 

uacaucauugaucuugcuaucucc

 - 109

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).