Stem-loop sequence ppy-mir-490

AccessionMI0014963 (change log)
DescriptionPongo pygmaeus miR-490 stem-loop
Gene family MIPF0000229; mir-490
Stem-loop
   u     -cc      g    -   aguucauu        c      --         g   caa   u 
5'  ggagg   uugcug uuug gaa        guucgaca caugga  ucuccaggu ggu   guu a
    |||||   |||||| |||| |||        |||||||| ||||||  ||||||||| |||   |||  
3'  ccuuc   ggcgac gagc cuu        cgaguugu guaccu  ggaggucca cca   uag g
   a     aca      -    a   ------gu        c      ca         a   -cg   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr7: 134014984-134015111 [+]
intergenic
Database links

Mature sequence ppy-miR-490-5p

Accession MIMAT0015909
Sequence

39 - 

ccauggaucuccaggugggu

 - 58

Get sequence
Evidence not experimental

Mature sequence ppy-miR-490-3p

Accession MIMAT0015910
Sequence

76 - 

caaccuggaggacuccaugcug

 - 97

Get sequence
Evidence not experimental

References

1