Stem-loop sequence cin-mir-4024

AccessionMI0015575 (change log)
DescriptionCiona intestinalis miR-4024 stem-loop
Stem-loop
   uuu       g          uacauagcaacaugca 
5'    guaggau aaaaggugaa                c
      ||||||| ||||||||||                c
3'    uauccua uuuucuacuu                a
   --g       g          uuauauuuaaauuaua 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
4q: 3219604-3219678 [-]
intergenic
scaffold_1418: 6314-6388 [+]
intergenic
Database links

Mature sequence cin-miR-4024-5p

Accession MIMAT0016539
Sequence

1 - 

uuuguaggaugaaaaggug

 - 19

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4024-3p

Accession MIMAT0016540
Sequence

56 - 

uuucaucuuuugauccuaug

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1