Stem-loop sequence cin-mir-4132

AccessionMI0015687 (change log)
DescriptionCiona intestinalis miR-4132 stem-loop
Stem-loop
   c       -aaa   c      guc 
5'  aaugcaa    ggc auuugu   g
    |||||||    ||| ||||||    
3'  uuauguu    ucg uaaaca   a
   a       guag   u      aua 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
7q: 4818326-4818376 [+]
intergenic
Database links

Mature sequence cin-miR-4132-5p

Accession MIMAT0016728
Sequence

1 - 

caaugcaaaaaggccauuug

 - 20

Get sequence
Deep sequencing15 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4132-3p

Accession MIMAT0016729
Sequence

32 - 

aaauugcugauguuguauua

 - 51

Get sequence
Evidence experimental; Illumina [1]

References

1