Stem-loop sequence cin-mir-4186

AccessionMI0015743 (change log)
DescriptionCiona intestinalis miR-4186 stem-loop
Stem-loop
   c     g       a u          aca    u 
5'  uagau aggcaag g gaguguuauu   aaag g
    ||||| ||||||| | ||||||||||   ||||  
3'  aucua ucuguuc c cucacaauaa   uuuc g
   a     a       a c          --a    u 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
8q: 4071088-4071157 [-]
intergenic
Database links

Mature sequence cin-miR-4186-5p

Accession MIMAT0016804
Sequence

1 - 

cuagaugaggcaagagugag

 - 20

Get sequence
Deep sequencing16 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1