Stem-loop sequence bta-mir-3602

AccessionMI0015948 (change log)
DescriptionBos taurus miR-3602 stem-loop
Stem-loop
   -cacau  aac                  ----a           uaaua 
5'       cc   acgugacguguugggauc     ccgcgguaagu     u
         ||   ||||||||||||||||||     |||||||||||     c
3'       gg   ugcacugcacaacccuag     ggugccauuca     a
   acgaau  cua                  gagag           cauag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bta-miR-3602

Accession MIMAT0016937
Sequence

18 - 

guguugggaucaccgcgguaa

 - 38

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:19765282 "Identification and characterization of miRNAs expressed in the bovine ovary" Hossain MM, Ghanem N, Hoelker M, Rings F, Phatsara C, Tholen E, Schellander K, Tesfaye D BMC Genomics. 10:443(2009).