Stem-loop sequence rlcv-mir-rL1-24

AccessionMI0013283 (change log)
DescriptionRhesus lymphocryptovirus miR-rL1-24 stem-loop
Gene family MIPF0000948; mir-BART18
Stem-loop
      g      cc    -c         c      a     --   u 
5' cgu cgggug  cugg  ucaaguucu auuucc auaca  guu g
   ||| ||||||  ||||  ||||||||| |||||| |||||  |||  
3' gua gcccgu  gacc  aguucagga uagagg uaugu  caa a
      -      uu    au         -      c     uc   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rlcv-miR-rL1-24-5p

Accession MIMAT0016947
Sequence

17 - 

cucaaguucucauuuccaauac

 - 38

Get sequence
Evidence experimental; Northern [1], PCR [1], Illumina [2-3]

Mature sequence rlcv-miR-rL1-24-3p

Accession MIMAT0016948
Sequence

54 - 

uaucggagauaggacuugauacc

 - 76

Get sequence
Evidence experimental; Northern [1], PCR [1], Illumina [2-3]

References

1
PMID:19889779 "A global analysis of evolutionary conservation among known and predicted gammaherpesvirus microRNAs" Walz N, Christalla T, Tessmer U, Grundhoff A J Virol. 84:716-728(2010).
2
PMID:20219930 "Comprehensive analysis of Rhesus lymphocryptovirus microRNA expression" Riley KJ, Rabinowitz GS, Steitz JA J Virol. 84:5148-5157(2010).
3
PMID:24257599 "Evolutionary conservation of primate lymphocryptovirus microRNA targets" Skalsky RL, Kang D, Linnstaedt SD, Cullen BR J Virol. 88:1617-1635(2014).