Stem-loop sequence aly-MIR827

AccessionMI0014605 (change log)
DescriptionArabidopsis lyrata miR827 stem-loop
Gene family MIPF0001113; MIR827_3
Stem-loop
   uacaucuuuaacuuccau       -ua         -uucucucu     -c  u    u            u a      u  au      aauc     g 
5'                   gaaacau   uaggguuuu         ugcaa  cc ugaa guguuuguugau g caucua ac  aucgau    cuauc u
                     |||||||   |||||||||         |||||  || |||| |||||||||||| | |||||| ||  ||||||    ||||| g
3'                   uuuugua   guucuaaag         acguu  gg gcuu cgcaaacaacua c guagau ug  uagcua    gauag u
   -----auguuucuacgau       cua         uucuucgcu     uu  u    u            c a      u  gu      ----     u 
Get sequence
Deep sequencing
17 reads, 500 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348717.1: 19566549-19566745 [-]
intergenic
Database links

Mature sequence aly-miR827-5p

Accession MIMAT0017607
Previous IDsaly-miR827*
Sequence

62 - 

uuuguugauugacaucuauac

 - 82

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR827-3p

Accession MIMAT0017608
Previous IDsaly-miR827
Sequence

120 - 

uuagaugaccaucaacaaacg

 - 140

Get sequence
Deep sequencing16 reads, 1 experiments
Evidence experimental; Illumina [1], SOLiD [2]
Database links

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2