Stem-loop sequence aly-MIR774b

AccessionMI0014650 (change log)
DescriptionArabidopsis lyrata miR774b stem-loop
Gene family MIPF0001101; MIR774
Stem-loop
        -c        u          a     a   c     acu       au 
5' ggauu  acuugaga gaagauuugg ugaca aua uuaaa   uugguaa  u
   |||||  |||||||| |||||||||| ||||| ||| |||||   |||||||  u
3' ucuaa  uggacucu cuucuaaacc acugu uau aauuu   aaccauu  a
        uu        c          c     c   u     ---       aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0; GCA_000004255.1) Overlapping transcripts
GL348714.1: 3372279-3372385 [-]
intergenic
Clustered miRNAs
< 10kb from aly-MIR774b
aly-MIR859GL348714.1: 3372640-3372797 [-]
aly-MIR774aGL348714.1: 3372430-3372563 [-]
aly-MIR774bGL348714.1: 3372279-3372385 [-]
Database links

Mature sequence aly-miR774b-5p

Accession MIMAT0017699
Previous IDsaly-miR774b
Sequence

10 - 

ugagaugaagauuuggaugac

 - 30

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

Mature sequence aly-miR774b-3p

Accession MIMAT0017700
Previous IDsaly-miR774b*
Sequence

79 - 

cacccaaaucuuccucucagg

 - 99

Get sequence
Evidence experimental; Illumina [1], SOLiD [2]

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).
2