Stem-loop sequence ngi-mir-92a

AccessionMI0016648 (change log)
DescriptionNasonia giraulti miR-92a stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ------u     aaaa         a   u    g       ucguaau  u 
5'        ugcau    gauaggucg gau ggug caauguu       gg u
          |||||    ||||||||| ||| |||| |||||||       ||  
3'        acgua    cuauccggc cug ucac guuauaa       cc u
   uauaauc     -agg         c   u    -       ----cuc  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ngi-miR-92a

Accession MIMAT0018407
Sequence

58 - 

auugcacuugucccggccuau

 - 78

Get sequence
Evidence not experimental

References

1
"Computational Identification and Characterization of Putative miRNAs in Nasonia Species" Sathyamurthy G, Swamy NR Int J Insect Sci. 2:1-13(2010).