Stem-loop sequence ame-mir-3793

AccessionMI0016207 (change log)
DescriptionApis mellifera miR-3793 stem-loop
Stem-loop
   uuu     u     cc    -a  -        -     cgc 
5'    gagcg guuuu  cugg  cu ggucuauc ugucg   g
      ||||| |||||  ||||  || |||||||| |||||    
3'    uuugc caaag  gacc  ga ccaggugg gcagu   a
   --c     u     aa    gc  u        u     ucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000068.5: 1064043-1064123 [-]
intergenic
Database links

Mature sequence ame-miR-3793-5p

Accession MIMAT0018577
Sequence

3 - 

ugagcguguuuucccuggacug

 - 24

Get sequence
Evidence experimental; SOLID [1], Illumina [2]

References

1
PMID:20807255 "Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera" Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F Insect Mol Biol. 19:799-805(2010).
2
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).