Stem-loop sequence pma-mir-25b

AccessionMI0017029 (change log)
DescriptionPetromyzon marinus miR-25b stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   gucu  a     ---  a      g        a    g    cu    c 
5'     gg cggcg   cg gcaggc gagacugg gcaa ugcu  acca u
       || |||||   || |||||| |||||||| |||| ||||  ||||  
3'     cc gccgc   gc cgucug cucugauc cguu acgg  uggu c
   ---c  -     uga  c      a        a    -    --    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Petromyzon_marinus-7.0; GCA_000148955.1) Overlapping transcripts
GL478379.1: 408922-409013 [+]
intergenic
Clustered miRNAs
< 10kb from pma-mir-25b
pma-mir-17aGL478379.1: 403379-403460 [+]
pma-mir-18bGL478379.1: 403671-403761 [+]
pma-mir-17bGL478379.1: 404297-404390 [+]
pma-mir-19cGL478379.1: 404996-405075 [+]
pma-mir-20aGL478379.1: 406609-406699 [+]
pma-mir-19bGL478379.1: 406814-406897 [+]
pma-mir-92aGL478379.1: 407029-407108 [+]
pma-mir-25bGL478379.1: 408922-409013 [+]
Database links

Mature sequence pma-miR-25b-5p

Accession MIMAT0019406
Previous IDspma-miR-25b*
Sequence

19 - 

ggcggagacuggagcaagugcuc

 - 41

Get sequence
Evidence experimental; 454 [1]

Mature sequence pma-miR-25b-3p

Accession MIMAT0019407
Previous IDspma-miR-25b
Sequence

57 - 

cauugcacuagucucagucugc

 - 78

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).