Stem-loop sequence pma-mir-146

AccessionMI0017081 (change log)
DescriptionPetromyzon marinus miR-146 stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
     g     u          uu  a        ga  a 
5' cc ggcgg gagaacugaa  cc uaggcugu  cg c
   || ||||| ||||||||||  || ||||||||  ||  
3' gg cugcc cuuuugacuu  gg guccgacg  gu a
     a     u          cu  -        ac  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence pma-miR-146-5p

Accession MIMAT0019478
Previous IDspma-miR-146
Sequence

9 - 

ugagaacugaauuccauaggcu

 - 30

Get sequence
Evidence experimental; 454 [1]

Mature sequence pma-miR-146-3p

Accession MIMAT0019479
Previous IDspma-miR-146*
Sequence

47 - 

agccugggucuucaguuuucucc

 - 69

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20959416 "microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate" Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ Proc Natl Acad Sci U S A. 107:19379-19383(2010).