Stem-loop sequence tcc-MIR827

AccessionMI0017533 (change log)
DescriptionTheobroma cacao miR827 stem-loop
Gene family MIPF0000863; MIR827_2
Stem-loop
   aaauu     uu  --    ua                   ---u        uu   cucuu     -c  u   c 
5'      augca  au  ugaa  uguuuguugauggucaucu    gucauuuu  cac     cuugg  cu gua c
        |||||  ||  ||||  |||||||||||||||||||    ||||||||  |||     |||||  || ||| a
3'      uacgu  ug  acuu  acaaacaacuaccaguaga    uaguaaga  gug     gaacc  ga cgu g
   --ucu     uu  cu    uc                   uucg        -c   ugcuu     au  c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tcc-miR827

Accession MIMAT0020449
Sequence

108 - 

uuagaugaccaucaacaaaca

 - 128

Get sequence
Evidence not experimental

References

1
PMID:21186351 "The genome of Theobroma cacao" Argout X, Salse J, Aury JM, Guiltinan MJ, Droc G, Gouzy J, Allegre M, Chaparro C, Legavre T, Maximova SN, Abrouk M, Murat F, Fouet O, Poulain J, Ruiz M, Roguet Y, Rodier-Goud M, Barbosa-Neto JF, Sabot F, Kudrna D, Ammiraju JS, Schuster SC, Carlson JE, Sal Nat Genet. 43:101-108(2011).