Stem-loop sequence bdi-MIR166f

AccessionMI0018083 (change log)
DescriptionBrachypodium distachyon miR166f stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention bdi-MIR166f
(19 sentences)

Stem-loop
   -----aggggaagag  -      a      cu         g   a   a           ccg      u u 
5'                ag ggaagc uggugu  ggaauggag cug ucc agauccuuggu   aaauau g g
                  || |||||| ||||||  ||||||||| ||| ||| |||||||||||   |||||| | u
3'                uc ccuucg gccaca  ccuuacuuc gac agg ucuaggaaccg   uuugug c u
   cuuuguguuagagcg  g      a      cu         g   c   c           uug      u u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 6090867-6091011 [-]
intergenic
Database links

Mature sequence bdi-miR166f

Accession MIMAT0020658
Sequence

92 - 

ucucggaccaggcuucauucc

 - 112

Get sequence
Evidence not experimental

References

1
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).