Stem-loop sequence mtr-MIR160f

AccessionMI0018371 (change log)
DescriptionMedicago truncatula miR160f stem-loop
Gene family MIPF0000032; MIR160
Literature search

5 open access papers mention mtr-MIR160f
(16 sentences)

Stem-loop
   -aauguug       c         g       ua       c  c    a 
5'         uguuugc uggcucccu caugcca  uaagagg uu ucaa a
           ||||||| ||||||||| |||||||  ||||||| || |||| u
3'         acggacg acugaggga gugcggu  auuuucc ag aguu g
   cuaauccg       a         a       uc       c  c    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
AC233669.2: 28227-28330 [-]
intergenic
Database links

Mature sequence mtr-miR160f

Accession MIMAT0021268
Sequence

74 - 

gcgugaagggagucaagcagg

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).