Stem-loop sequence mtr-MIR5276

AccessionMI0018417 (change log)
DescriptionMedicago truncatula miR5276 stem-loop
Stem-loop
   --aa   u  aua         c    c     ca  g    a  ugguu 
5'     gca au   gggggagca cuug ugggg  ug cugg gc     g
       ||| ||   ||||||||| |||| |||||  || |||| ||      
3'     cgu ua   cccccucgu ggac acccc  ac gacc cg     g
   accc   c  aac         c    a     uc  a    -  cuggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 21101295-21101393 [+]
intergenic
chr5: 21265652-21265750 [-]
intergenic
Database links

Mature sequence mtr-miR5276

Accession MIMAT0021314
Sequence

11 - 

agggggagcaccuugcuggggcau

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).