Stem-loop sequence asu-mir-100a-1

AccessionMI0018562 (change log)
DescriptionAscaris suum miR-100a-1 stem-loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention asu-mir-100a-1
(17 sentences)

Stem-loop
   ------      aa     u   uc    c        ugu 
5'       ggcggu  acccg aga  cgaa uuguguug   a
         ||||||  ||||| |||  |||| ||||||||   u
3'       ucgcua  ugggc ucu  gcuu aacgcaau   u
   gauuag      cg     -   cc    -        ggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-100a-5p

Accession MIMAT0021487
Previous IDsasu-miR-100a
Sequence

8 - 

aacccguagauccgaacuuguguu

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-100a-1-3p

Accession MIMAT0021488
Previous IDsasu-miR-100a-1*
Sequence

45 - 

cgcaauucgccucucgggugca

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).