Stem-loop sequence asu-mir-100d

AccessionMI0018566 (change log)
DescriptionAscaris suum miR-100d stem-loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention asu-mir-100d
(14 sentences)

Stem-loop
       -gg     a     u       ug        ggg 
5' gaug   cggug acccg augcugu  gguguguu   u
   ||||   ||||| ||||| |||||||  ||||||||   u
3' cugc   gccac ugggc uguggca  ucgcacag   c
       gga     c     u       --        ugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-100d-5p

Accession MIMAT0021493
Previous IDsasu-miR-100d
Sequence

12 - 

aacccguaugcuguugggugugu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-100d-3p

Accession MIMAT0021494
Previous IDsasu-miR-100d*
Sequence

47 - 

cacgcuacgguguucgggucc

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).