Stem-loop sequence asu-mir-5362

AccessionMI0018613 (change log)
DescriptionAscaris suum miR-5362 stem-loop
Stem-loop
   -----u  g    ua      gu     a   u    gagu 
5'       gu cagu  aaucuc  ccggu gua augc    u
         || ||||  ||||||  ||||| ||| ||||     
3'       ca guca  uuagag  ggcca cgu uacg    g
   ucucuu  -    cc      gu     a   -    aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence asu-miR-5362-5p

Accession MIMAT0021586
Previous IDsasu-miR-5362
Sequence

10 - 

aaaucucguccgguaguauaugc

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence asu-miR-5362-3p

Accession MIMAT0021587
Previous IDsasu-miR-5362*
Sequence

45 - 

auugcaaccgguggagauucca

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21685128 "Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles" Wang J, Czech B, Crunk A, Wallace A, Mitreva M, Hannon GJ, Davis RE Genome Res. 21:1462-1477(2011).