Stem-loop sequence aca-mir-215

AccessionMI0018818 (change log)
DescriptionAnolis carolinensis miR-215 stem-loop
Gene family MIPF0000063; mir-192
Stem-loop
   aaaa  ga   --u       a  a     -  uu      a ugu  uu 
5'     ug  ggc   uagggua ug ccuau ga  ugacag c   gc  u
       ||  |||   ||||||| || ||||| ||  |||||| |   ||  c
3'     ac  ccg   gucucau ac ggaug cu  acuguc g   ug  u
   ---c  uc   cau       a  c     u  uu      c -uc  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AnoCar2.0; GCA_000090745.2) Overlapping transcripts
chr1: 243290652-243290747 [-]
sense
ENSACAT00000020090 ; aca-mir-215-201; exon 1
antisense
ENSACAT00000001695 ; IARS2-201; intron 11
Clustered miRNAs
< 10kb from aca-mir-215
aca-mir-194-1chr1: 243290929-243291013 [-]
aca-mir-215chr1: 243290652-243290747 [-]
Database links

Mature sequence aca-miR-215-5p

Accession MIMAT0021873
Previous IDsaca-miR-215
Sequence

20 - 

augaccuaugauuugacagacu

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aca-miR-215-3p

Accession MIMAT0021874
Previous IDsaca-miR-215*
Sequence

59 - 

cugucauuucuguaggccaaua

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21775315 "MicroRNAs support a turtle + lizard clade" Lyson TR, Sperling EA, Heimberg AM, Gauthier JA, King BL, Peterson KJ Biol Lett. 8:104-107(2012).