Stem-loop sequence osa-MIR5534b

AccessionMI0019055 (change log)
DescriptionOryza sativa miR5534b stem-loop
Gene family MIPF0001324; MIR5534
Stem-loop
   a      ----     ug                 c  gg  a   a  a 
5'  acuuug    uucga  acaacagcuagaauggc gc  cg cgg gg u
    ||||||    |||||  ||||||||||||||||| ||  || ||| || u
3'  ugaaau    gagcu  uguugucgaucuuaccg cg  gu gcc cc g
   -      cgca     gu                 c  ga  a   c  u 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 6404422-6404519 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR5534b
osa-MIR5534bChr11: 6404422-6404519 [-]
osa-MIR5534aChr11: 6404295-6404396 [-]
Database links

Mature sequence osa-miR5534b

Accession MIMAT0022170
Sequence

10 - 

cgaugacaacagcuagaaugg

 - 30

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1