Stem-loop sequence mtr-MIR5556

AccessionMI0019081 (change log)
DescriptionMedicago truncatula miR5556 stem-loop
Stem-loop
   gu              a        c    c  c       a   aa   -----   c  a 
5'   caagaucauuugga uucuuccg cauc aa gaaccuu gag  cag     cuc ac a
     |||||||||||||| |||||||| |||| || ||||||| |||  |||     ||| ||  
3'   guucuaguaaaccu aagaaggc guag uu cuuggaa cuc  guu     gag ug u
   uu              a        a    u  a       c   ca   ccuca   u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 25278547-25278667 [-]
intergenic
Database links

Mature sequence mtr-miR5556-5p

Accession MIMAT0022211
Previous IDsmtr-miR5556*
Sequence

13 - 

uggaauucuuccgccauccaa

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR5556-3p

Accession MIMAT0022212
Previous IDsmtr-miR5556
Sequence

91 - 

ugaugacggaagaaauccaaa

 - 111

Get sequence
Evidence experimental; Illumina [1-2]

References

1
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).