Stem-loop sequence ola-mir-301a

AccessionMI0019498 (change log)
DescriptionOryzias latipes miR-301a stem-loop
Gene family MIPF0000034; mir-130
Stem-loop
   -gcccga  u   gg        c    --uu -            u  c 
5'        gc guu  caggugcu ugac    c auugcacuacug au a
          || |||  |||||||| ||||    | |||||||||||| || g
3'        cg caa  guuuacga acug    g uaacgugaugau ua a
   cgagaaa  u   aa        a    uuau a            c  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
14: 13145539-13145637 [+]
sense
ENSORLT00000006933 ; im:7140390-201; intron 1
Database links

Mature sequence ola-miR-301a-5p

Accession MIMAT0022620
Sequence

20 - 

gcucugacuucauugcacuac

 - 40

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence ola-miR-301a-3p

Accession MIMAT0022621
Sequence

59 - 

gugcaauaguauugucaaagca

 - 80

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).