Stem-loop sequence ola-mir-92b

AccessionMI0019516 (change log)
DescriptionOryzias latipes miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

1 open access papers mention ola-mir-92b
(2 sentences)

Stem-loop
   ---uucc     -a       c    g       c      c     uc ugu 
5'        ucccg  ggucggg aggu cgggaug agugca uguug  g   u
          |||||  ||||||| |||| ||||||| |||||| |||||  |    
3'        ggggc  ccggccc uccg gcccugu ucacgu auaac  c   c
   aagaauc     cc       c    -       -      u     cu ccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MEDAKA1) Overlapping transcripts
16: 29384732-29384833 [+]
intergenic
Database links

Mature sequence ola-miR-92b

Accession MIMAT0022637
Sequence

61 - 

uauugcacuugucccggccuccc

 - 83

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:21143817 "Discovery and characterization of medaka miRNA genes by next generation sequencing platform" Li SC, Chan WC, Ho MR, Tsai KW, Hu LY, Lai CH, Hsu CN, Hwang PP, Lin WC BMC Genomics. 11 Suppl 4:S8(2010).